plko 1 teton puro vector (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
plko 1 teton puro vector
Plko 1 Teton Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 706 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tet+plko+1+puro+vector/Tet-pLKO-puro+(Plasmid+%2321915)/pm41708864-575-13-15
Average 96 stars, based on 706 article reviews
Plko 1 Teton Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 706 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tet+plko+1+puro+vector/Tet-pLKO-puro+(Plasmid+%2321915)/pm41708864-575-13-15
Average 96 stars, based on 706 article reviews
plko 1 teton puro vector - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Construct:Article Title: RB1 loss triggers dependence on ESRRG in retinoblastoma Article Snippet: .. Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA ( ) and GAACGATTATCCATTCAAA ( ) targeting human RB1 (shRB1) into Article Title: RB1 loss triggers dependence on ESRRG in retinoblastoma Article Snippet: .. Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences 5′-GAAAGGACATGTGAACTTA-3′ ( ) and 5′-GAACGATTATCCATTCAAA-3′ ( ) targeting human RB1 (shRB1) into shRNA:Article Title: NAT10 promotes cancer metastasis by modulating p300/CBP activity through chromatin-associated tRNA Article Snippet: Lentiviral shRNA targeting the anti-codon loop of specific tRNAs, tRNA-Ser-TGA (GGCGATGGACTTGAAATCCATTG) and tRNA-Leu-CAG (GGCGCTGCGTTCAGGTCGCAGTC) was designed and cloned into pLKO.1-Blast backbone vector received from Dr. Keith Mostov’s Lab (Addgene # 26655). pLKO.1-Blast-Scramble (CCTAAGGTTAAGTCGCCCTCG) (Addgene # 26701) was used as non-targeting control. .. For the generation of doxycycline-inducible shRNA targeting human NAT10, shRNAs TRCN0000035699 (sh-NAT10-B4, AATTCAGGATTTAGAGACTGG) and TRCN0000035703 (sh-NAT10-B8, ATAGTCACTGTGTACAATTGC) were cloned into Article Title: NAT10 promotes cancer metastasis by modulating p300/CBP activity through chromatin-associated tRNA. Article Snippet: Lentiviral shRNA targeting the anti-codon loop of specific tRNAs, tRNASer-TGA (GGCGATGGACTTGAAATCCATTG) and tRNA-Leu-CAG (GGCGCTGCGTTCAGGTCGCAGTC) was designed and cloned into pLKO.1-Blast backbone vector received from Dr. Keith Mostov’s Lab (Addgene # 26655). pLKO.1-Blast-Scramble (CCTAAGGTTAAGTCGCCCTCG) (Addgene # 26701) was used as non-targeting control. .. For the generation of doxycycline-inducible shRNA targeting human NAT10, shRNAs TRCN0000035699 (sh-NAT10-B4, AATTCAGGATTTAGAGACTGG) and TRCN0000035703 (sh-NAT10-B8, ATAGTCACTGTGTACAATTGC) were cloned into Clone Assay:Article Title: NAT10 promotes cancer metastasis by modulating p300/CBP activity through chromatin-associated tRNA Article Snippet: Lentiviral shRNA targeting the anti-codon loop of specific tRNAs, tRNA-Ser-TGA (GGCGATGGACTTGAAATCCATTG) and tRNA-Leu-CAG (GGCGCTGCGTTCAGGTCGCAGTC) was designed and cloned into pLKO.1-Blast backbone vector received from Dr. Keith Mostov’s Lab (Addgene # 26655). pLKO.1-Blast-Scramble (CCTAAGGTTAAGTCGCCCTCG) (Addgene # 26701) was used as non-targeting control. .. For the generation of doxycycline-inducible shRNA targeting human NAT10, shRNAs TRCN0000035699 (sh-NAT10-B4, AATTCAGGATTTAGAGACTGG) and TRCN0000035703 (sh-NAT10-B8, ATAGTCACTGTGTACAATTGC) were cloned into Article Title: NAT10 promotes cancer metastasis by modulating p300/CBP activity through chromatin-associated tRNA. Article Snippet: Lentiviral shRNA targeting the anti-codon loop of specific tRNAs, tRNASer-TGA (GGCGATGGACTTGAAATCCATTG) and tRNA-Leu-CAG (GGCGCTGCGTTCAGGTCGCAGTC) was designed and cloned into pLKO.1-Blast backbone vector received from Dr. Keith Mostov’s Lab (Addgene # 26655). pLKO.1-Blast-Scramble (CCTAAGGTTAAGTCGCCCTCG) (Addgene # 26701) was used as non-targeting control. .. For the generation of doxycycline-inducible shRNA targeting human NAT10, shRNAs TRCN0000035699 (sh-NAT10-B4, AATTCAGGATTTAGAGACTGG) and TRCN0000035703 (sh-NAT10-B8, ATAGTCACTGTGTACAATTGC) were cloned into |